Min studentmössa.

 
JAAAA, min studentmössa kom äntligen idag!! Jag har typ varit sist med att få min känns det som haha!
Men den som väntar på något gott väntar väl aldrig för länge. ; )
#105dagarkvar.

 
RÄTT TJUSIG VA!? :D

Nu börjar man ju tagga ännu mer. Iiiiih, inte långt kvar alls nu ju!!!

Hej våren!

 

Du är mer än välkommen hit - äntligen lite vårkänsla! 
Det är så konstigt att vädret kan påverka en så mycket. Bara lite ljusare & varmare så får man så himla mycket energi i kroppen, gladgladglad! : D FRAM MED SOLGLAJJORNA!
 
 
<VÅR3

Slut på lov.

 
En bild från studentkryssningen.
Knäppisen i glitterkjolen, det är jag. Resten är mina kompisar. Så söta så! : D  
 
Himla roligt var det också förresten! (Om jag inte hunnit berätta det ännu.)
Jag blev dock megaförkyld efter det. Fortfarande inte helt frisk. 
Men jag har en extra dag ledigt från skolan, så kanske jag hinner bli lite friskare också. - endel börjar ju skolan imorgon efter sportlovet. 

Har ni haft ett bra lov? : )

100 frågor - #7, #8

 
De andra frågorna & svaren hittar ni i kategorin ''True shit''.
 

61. Är du petig när det kommer till stavning och grammatik?
Ja faktiskt. Jag stör mej ganska rejält på när jag ser felstavningar & särskrivningar osv iallafall. (Hehe)
 
62. Tror du på liv på andra planeter?
Kanske! Man vet aldrig. :0

63 Vem var den senaste personen som gjorde dig arg?
Det var nog en kompis, som jag förövrigt är sams med nu dock.

64. Vem var den senaste personen som gjorde dig glad?
Min Daniel♥
 
65. Vad var det senaste du åt?
Grillchips.
 
66. Kommer du bäst överens med personer av samma kön eller motsatta?
Det motsatta, tror jag.
(Men jag har såklart tjejkompisar som jag kommer överens med också.)
 
67. Vad vill du att dina barn ska heta?
Det har jag inte bestämt än. Men något kort, ovanligt & fint namn tycker jag.

68. Gillar du senap?
Nej, usch!
 
69. Vad säger du till dig själv när allt känns svårt?
''Gå & lägg dej''.

70. Skulle du någonsin hoppa fallskärm?
ALDRIG.
 
71. Har du varit inblandad i en trafikolycka?
Ja. Min kompis & jag blev påkörda av en bil på ett övergångsställe för några år sen.
Någonting som jag aldrig glömmer.
 
72. Har du någonsin köpt något ifrån eBay?
Nej, faktiskt inte.

73. Tycker du om att krama folk?
Ja, kramar är mysiga. :')
 
74. Stör det dig om någon säger att dom ska ringa men inte gör det?
Men jo, lite arg blir man kanske om det är viktigt.

75. Vilka böcker, om några, har fått dig att gråta?
Ingen bok. BRA TITEL...

76. Vilka kändisar har du blivit jämförd med?
Anne Hathaway. Britney Spears. Haha?
 Jag vet faktiskt inte riktigt vad jag tycker om den saken. Vad säger ni?
 
77. Vad är du allergisk mot?
Ingenting direkt. Men jag är överkänslig mot myggbett - dock så var det mycket värre förr.

78. Får du dåligt samvete efter du ätit kött?
Kött är gött. Jo, men ibland faktiskt. ):

79. Om du var född av motsatt kön, vad hade du hetat?
Rickard....

80. Vad är det första du gör när du går upp på morgonen?
Kollar facebook. (:$)

Carolina Liar.

 
Vet inte om jag är efter eller så, men jag har hittat dessa låtar typ nyss & jag älskar varenda en.
SÅ BRAAAA!
 




Underbart >>> LYSSNA!

SPORTLOVSPLANER.

 
Megagammal tokbild.
 
ÄNTLIGEN SPORTLOV säger jag bara!

Idag, måndag, ska jag ta bussen hemåt från älsklingen, packa mitt pick&pack & dra till Josefine för övernattning. För imorgon, tisdag är det S T U D E N T K R Y S S N I I I I I I I  N G ! (taggataggataggatagga)
 
Parta hela natten, käka mat, tralla runt på en båt med de två vännerna & Jerry (Jerry - jag)
 
Någon dag efter partydagarna ska jag hitta en dag & umgås med min bästa Julia♥, sedan ska jag gratta min fader som fyller år på lördag.
Annars vet jag inte om jag har så mycket mer planerat detta lov. Men det är skönt det.
Inte långt kvar till studenten nu, dagen med stort D. Det närmar sig med stoooormsteg!
 
Vad har ni för planer på sportlovet?!
 
Ha det bäst hörrni! ♥

Glad alla <3s dag!




Hej alla hjärtisar! (hihi)
Vad har ni gjort idag? :D

Jag har tillbringat den tillsammans med min älskling, så mysigt!
Vi har blivit pålurade en surfplatta, beställt pizza och bara chillat. Bara man umgås och bryr sig om varandra så spelar det ingen roll vad man gör denna överskattade dag <3

Nu ska vi kika på film & smaska i oss godis. : D

Ha en bra kväll allihopa!

Teen-derp.

HAHA, stämmer det in på er också?

Satt länge och skrattade åt sånnahär Teen-Derp för några år sen... Haha så kul. :'D
 
 

Svartvitt från Junkyard.

 
 
 

För många är svart & vit en ganska tråkig kombo, men för mej kan det inte bli snyggare! Bara man slänger på lite snygga detaljer; så som smycken, klockor eller färgglada mössor så blir det toppensnyggt. : ) 
Nike-skorna gör allt tycker jag, grymma!♥ 

Jag vill ha vår.

 
Två bilder som jag har tagit i mars förra året. Snön började smälta & det blev varmare & varmare...
 ♥
& om lite mindre än 3 veckor fyller jag 19. Jag önskar mej vår i födelsedagspresent.
 

Lagom arg.

 
ÅÅÅH, jag blir så trött!
Först går halvljuslamporna på min bil sönder, sen går min systemkamera sönder...
& nu - min mobil, OCKSÅ! 
 
Man blir ju galen. Fattas väl bara att min dator går sönder igen också...
 
Fast min mobil får jag delvis skylla mej själv för. Jag tappade den i backen igår & skärmen är helt svart nu även fast själva telefonen är igång.  Så typiskt att detta ska hända mej. Jävla tur i allt. Aaarggggh!!!
 
 
 

Filmtips #4 - Jennifer Aniston.

 
Himla bra skådespelerska, i alla filmer jag sett henne i. & det är ju många också. : )
Här är iallafall mina 10 favoriter med henne:
 
 
& så måste ni självklart kolla på den nyaste filmen som hon är medverkande i: We're The Millers (Familjetrippen)! Himla rolig film : D 
Likaså de andra filmerna ovan. 
 

Check.

 
 
Praktikplats - CHECK.
Studentklänning - CHECK. 
Köpt nya halvljuslampor till lilla bilen - CHECK.
 
 
 
Idag är jag glad. Och trött. Men mest glad.
Jag blev så otroligt glad över studentklänningen som jag fick på posten idag! Jag trodde att den skulle vara större & inte alls passa så bra som den faktiskt gjorde. SÅ FIIIIN.♥ Jag är så glad att jag hann köpa den också, alla klänningar tar ju slut supersnabbt!
Jag kommer se ut som en gräddbakelse, wiiiie. KOM HIT NU STUDENTEN. #127dagarkvar. :D 

Min festiga helg.

 
Hej hallå kompisar! Hur är läääget? 
 
Min helg har varit helt okej!
i fredags var jag på krogen med några kompisar, fast kvällen slutade ganska tidigt ändå, så jag åkte hem till min pojkvän.
 
Lördagen bestod av mer party, fast 20-årsfest för pojkvännens kompis, mitt ute i skogen. Men det var trevligt, mycket folk!
 
I söndags mådde jag sämst, som jag förtjänade med andra ord. Fast det var längesen jag mådde som igår.
HELA dagen höll bakfyllan från helvetet i sig. Usch & fy!
 Men idag mår jag bra igen! Måndag - vilket betyder ledig för min del, hihi! Så skönt : )
 
En 1 år gammal bild på mej & mitt saknade röda hår.
 
 
& förresten, om jag har bloggläsare som bor i ÖREBRO-trakten så tipsa gärna om BRA RESTAURANGER!
(Vad som helst förutom snabbmatsställen!) Jag har även bil & körkort så jag kan lätt ta mej till ställen om det ligger utanför.  Det kan vara om du/ni ätit där någon gång.
Jag ska nämligen ha praktik i 5 veckor & det börjar närma sig. Tipsa tipsa tipsa!

RSS 2.0